Skip to content
Intră Creează cont

← Institutul de Diagnostic si Sanatate Animala

Amorsa Primer PCR Vir-F1 TGAGGGAGGTAGCATTGCAT 20 nmoli

DA21670420 · published 2018-11-06 · completed 2018-11-08 · from Filara BioMed Srl (Cluj-Napoca)

32 leiawarded value
—estimated value
33141625-7CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.

Description from SEAP

Amorsa Primer PCR Vir-F1 TGAGGGAGGTAGCATTGCAT 20 nmoli
// ~8,8 mil. de fișe aproape identice: rămân deschise și urmărite, dar în index intră paginile care le adună // (spital, furnizor, CPV, top) — altfel Google le vede ca pagini subțiri și consumă bugetul de crawl pe ele (decizia lui Alex, 24.09).