← Institutul de Diagnostic si Sanatate Animala
Primer PCR 1; Primer PCR 2; Primer PCR 4; Primer PCR 5; Primer PCR 6; Sonda PCR 7; Sonda PCR 8
DA22672577 · published 2019-03-25 · completed 2019-03-26 · from Filara BioMed Srl (Cluj-Napoca)
3,870 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
The text does mention: 1 buc, 1 buc, 1 buc, 1 buc (read automatically from title/description; check the text below).
Description from SEAP
Amorsa primer PCR 1 TACAACATGATGGGVAARAGAGAGA, purificare HPLC, 50 nmoli - 1 buc; Amorsa primer PCR 2 AGCATGTCTTCYGTBGTCATCCAYT, purificare HPLC, 50 nmoli - 1 buc; Amorsa primer PCR 3 CCTGTGTGAGCTGACAAACTTAGT, purificare HPLC, 50 nmoli - 1 buc; Amorsa primer PCR 4 GCGTTTTAGCATATTGACAGCC, purificare HPLC, 50 nmoli - 1 buc; Amorsa primer PCR 5 CAGCACAATGAAGATCAAGATCATC, purificare HPLC, 50 nmoli - 1 buc; Amorsa primer PCR 6 CGGACTCATCGTACTCCTGCTT, purificare HPLC, 50 nmoli - 1 buc; Amorsa Sonda PCR 7 5’ – FAM – CCTGGTTTCTTAGACATCGAGATCT – BHQ– 3, 5 nmoli - 1 buc; Amorsa sonda PCR 8 5’ – VIC – TCGCTGTCCACCTTCCAGCAGATGT – TAMRA – 3’, 5 nmoli - 1 buc. Mentionam ca aceasta reprezinta comanda ferma.