← Institutul de Diagnostic si Sanatate Animala
Primeri
DA23062735 · published 2019-05-17 · completed 2019-05-20 · from Filara BioMed Srl (Cluj-Napoca)
143 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Primer CF1 GGAGGATGACACTTTTCGGAGCG, 20 nmoli Primer CR2 TCGCGGTATTGCGTCTCATTGTATATGC, 20 nmoli Primer C412F GGATGACACTTTTCGGAGC, 20 nmoli Primer C1228R CATTGTAGCACGTGTGTC, 20 nmoli Mentionam ca aceasta reprezinta comanda ferma.