← Institutul de Diagnostic si Sanatate Animala
Primeri si sonda
DA24098525 · published 2019-10-14 · completed 2019-10-14 · from Filara BioMed Srl (Cluj-Napoca)
863 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
The text does mention: 1 buc, 1 buc, 1 buc (read automatically from title/description; check the text below).
Description from SEAP
Amorsa PCR Primer campF2 CACGTGCTACAATGGCATAT, 20 nmoli - 1 buc. Amorsa PCR Primer campR2 GGCTTCATGCTCTCGAGTT, 20 nmoli - 1 buc. Amorsa PCR Sonda campP2 5’-FAM-CAGAGAACAATCCGAACTGGGACA-BHQ1-3, 5 nmoli - 1 buc. Mentionam ca aceasta reprezinta comanda ferma.