← Institutul National De Endocrinologie C.I. Parhon
,,Furnizare consumabile pentru pregatire practica personal laborator”
DA25054830 · published 2020-02-15 · completed 2020-02-20 · from Dexter Com S.R.L. (Bucuresti)
21 k leiawarded value
21 k leiestimated value
33696500-0CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
The text does mention: 1 buc, 25 buc, 1 buc, 1 buc (read automatically from title/description; check the text below).
Description from SEAP
Se doreste achizitia de consumabile si reactivi de laborator :1 Kit extractie ADN genomic Wizard® Genomic DNA Purification Kit 10ml , A1620 Promega Kit 100 izolari x 10ml 1kit 4850 Lei 2 Genome Lab DTCS Quick Start kit A608120 AbSciex/CEQ Kit 96 reactions 1 3850 Lei 3 Genome Lab separation Gel LPA I — 608010 AbSciex/CEQ Flac 10m1 96 reactions 2flac 2x 550 Lei 4 Genome Lab separation Buffer, 4-pk , 608012 AbSciex/CEQ 4x 96 reactii 1kit 350Lei 5 96 well plates PS nonsterile 100 PK 609844 AbSciex/CEQ Cutie 100 placi x96 1buc - 1575 Lei 6 Sample microtiter plate, 25 pk 609801 AbSciex/CEQ Cutie 25buc placi x96 1cutie - 1300Lei 7 DNA Sep Cap Array 33-75B 608087 AbSciex/CEQ 1 buc 800 reactions 1buc - 3900 Lei 8 GoTaq Flexi DNA polymerase, 500 U M7805 Promega Kit 500 units 3kits 3x 650 Lei 9 dNTP mix, 100 mM, 1000 pl U1515 Promega 3buc 3x 335 Lei 10 Sample Loading Solution (6 ml) 608082 Flac 6m1 96 reactions 1 390 Lei 11 Bromura de etidiu HSO41 Promega — flac 10m1 buc 1 300 Lei 12 Primeri B RAF F= 5'GCTTGCTCTGATAGGAAAAT3' R 5'GTAACTCAGCAGCATCTCAGG3' Custum DNA oligos IDTDNA — set 1 90 Lei 13 Primeri RET Exon 10 F 5'CAGAAAGGCACTGTGACCAA3' R 5'CTCCTGGGTGGAGTAACAGA3' Custum DNA oligos IDTDNA 1 set - 90 Lei 14 Prime in vederea pregatirii practice a cursantilor din cadrul proiectului,,Cresterea competentei profesionale a specialistilor din sectorul medical in implementarea programelor nationale din domeniul Endocrinologiei si Diabetului Zaharat – ENDODIAB'' Contract nr. POCU/91/4/8/107996