← Institutul de Diagnostic si Sanatate Animala
Amorsa PCR Sonda CtrS 5’; Amorsa PCR Sonda ProcS 5’
DA25376862 · published 2020-03-26 · completed 2020-03-27 · from Filara BioMed Srl (Cluj-Napoca)
2,968 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
The text does mention: 1 buc, 1 buc (read automatically from title/description; check the text below).
Description from SEAP
Amorsa PCR Sonda CtrS 5’ – VIC – TCGCTGTCCACCTTCCAGCAGATGT – TAMRA – 3’, 5 nmoli - 1 buc. Amorsa PCR Sonda ProcS 5’ – FAM – CCTGGTTTCTTAGACATCGAGATCT – TAMRA - 3’, 5 nmoli - 1 buc. Mentionam ca aceasta reprezinta comanda ferma.