← Institutul de Biochimie al Academiei Romane
Pachet primeri IDTDNA
DA26937721 · published 2020-11-27 · completed 2020-11-30 · from Dexter Com S.R.L. (Bucuresti)
360 leiawarded value
—estimated value
24950000-8CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Sequence Name attgtctgcaacgtccgtggaaagg oCe46 ctacttcacgggtgtttccagtctg oCe47 GCTGGTGTGGCAGGAGTCTCG oCe48 acactgttctgtttgtcgagacttgg oCe49 cgtttcaaagttaagtagtcggctgc oCe50 ttatggcgatgatcggagagcag oCe51 Scala de sinteza 25nmols – min garantat 15nmols, STD puri, liofilizati , aprox 1500 rxn – IDTDNA