Ugrás a tartalomra
Intră Creează cont

Institutul de Diagnostic si Sanatate Animala Bucureşti

Institutul de Diagnostic si Sanatate Animala

Az összes közvetlen beszerzés a kórház részéről, a legfrissebbek elöl.

8162beszerzés · 09.03.2009 – 16.12.2022
13,6 M lejösszérték
206beszállító
DátumMiBecsültÉrtékMennyiségBeszállítóSz.KategóriaTelepülésCPV-kód
26.07.2018CC530A (304A) CARTUS TONER BLACK (3500 PAG) ORIGINAL HP LASERJET CP2025 M2320 —1640 lej — Dns Birotica S.R.L. DA20917408 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CF283A (83A) CARTUS TONER BLACK (1500 PAG) ORIGINAL HP LJ PRO M125NW M202N M126 M127 M225 M226 —804 lej — Dns Birotica S.R.L. DA20917377 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CE255X (55X) CARTUS TONER BLACK (12500 PAG) ORIGINAL HP LASERJET P3010 P3015 M521 —1180 lej — Dns Birotica S.R.L. DA20917357 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018C6615DE (15) CARTUS CERNEALA BLACK (500 PAG, 25 ML) ORIGINAL HP 920 —294 lej — Dns Birotica S.R.L. DA20917338 Cartuse de cerneala (Rev.2) Bucuresti 30192113-6
26.07.2018CF283A (83A) CARTUS TONER BLACK (1500 PAG) ORIGINAL HP LJ PRO M125NW M202N M126 M127 M225 M226 —1206 lej — Dns Birotica S.R.L. DA20917302 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC532A (304A) CARTUS TONER (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —608 lej — Dns Birotica S.R.L. DA20917277 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC533A (304A) CARTUS TONER (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —608 lej — Dns Birotica S.R.L. DA20917247 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC531A CARTUS TONER (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —912 lej — Dns Birotica S.R.L. DA20917221 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC530AD (304A) DUAL PACK CARTUS TONER BLACK (2x3.500 PAGINI) ORIGINAL HP LASERJET CP2025 —1200 lej — Dns Birotica S.R.L. DA20917187 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CF287A (87A) CARTUS TONER BLACK (9000 PAG) ORIGINAL HP M506 M527 MFP 527 —1476 lej — Dns Birotica S.R.L. DA20917159 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018TN-324BK TN-324K TN324BK TN324K CARTUS TONER BLACK(28000 PAG) ORIGINAL MINOLTA BIZHUB C308 C368 C258 —514 lej — Dns Birotica S.R.L. DA20915609 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CE255X (55X) CARTUS TONER BLACK (12500 PAG) ORIGINAL HP LASERJET P3010 P3015 M521 —2950 lej — Dns Birotica S.R.L. DA20915575 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC532A (304A) CARTUS TONER (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —304 lej — Dns Birotica S.R.L. DA20915516 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC533A CARTUS TONER (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —304 lej — Dns Birotica S.R.L. DA20915474 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC531A CC531 CC532A CC533A (304A) CARTUS TONER CMY (2800 PAG) ORIGINAL HP LJ CP2025 CM2320 —304 lej — Dns Birotica S.R.L. DA20915414 Cartuse de toner (Rev.2) Bucuresti 30125100-2
26.07.2018CC530A (304A) CARTUS TONER BLACK (3500 PAG) ORIGINAL HP LASERJET CP2025 M2320 —1640 lej — Dns Birotica S.R.L. DA20915252 Cartuse de toner (Rev.2) Bucuresti 30125100-2
25.07.2018Plic antisoc, Etichete autoadezive 24/A4, Etichete autoadezive 65/A4 —241 lej — Dns Birotica S.R.L. DA20910200 Articole de birou (Rev.2) Bucuresti 39263000-3
25.07.2018Cutie plastic pentru deseuri taietoare si intepatoare 5 L Cutie plastic pentru deseuri medicale 10 L —453 lej — Dns Birotica S.R.L. DA20910139 Containere pentru deseuri (Rev.2) Bucuresti 44613800-8
25.07.2018MIDDLEBROOK 7H10 AGAR BASE —1099 lej — Redox Research & Analytic S.R.L. DA20909747 Reactivi chimici (Rev.2) Otopeni 33696300-8
25.07.2018BULION NUTRITIV —154 lej — A.M.S. 2000 Trading Impex S.R.L. DA20909717 Reactivi chimici (Rev.2) Bucuresti 33696300-8
20.07.2018Condensator abur ISM2 —1874 lej — Isam Prodimpex S.R.L. DA20884060 Diverse piese de schimb (Rev.2) Bucuresti 34913000-0
20.07.2018AmpliTaq Gold DNA Polymerase, with Gold Buffer 1000 Units —11 ezer lej — Antisel Ro Srl DA20879001 Truse de diagnosticare (Rev.2) Bucuresti 33141625-7
20.07.2018AmpliTaq Gold DNA Polymerase, with Gold Buffer 1000 Units —14 ezer lej — Antisel Ro Srl DA20878983 Truse de diagnosticare (Rev.2) Bucuresti 33141625-7
19.07.2018Standard Quartz Torch for ELAN/NexION —1400 lej — Cromatec Plus S.R.L. DA20872622 Diverse piese de schimb (Rev.2) Tancabesti 34913000-0
17.07.2018AcT 5 Diff Control Plus, Act 5 diff Rinse —600 lej — Medist DA20859149 Reactivi chimici (Rev.2) Bucuresti 33696300-8
17.07.2018Kit ELISA Aflatoxina Totala, Coloane de imunoafinitate pentru aflatoxina totală din ţesuturi AFLATOX —3729 lej — Diamedix Impex DA20859043 Truse de diagnosticare (Rev.2) Bucuresti 33141625-7
17.07.2018STATIV PT EPRUBETE EPPENDORF —1528 lej — Brosser Technics DA20858937 Consumabile medicale (Rev.2) Bucuresti 33140000-3
17.07.2018Nutreturi combinate granulate pentru soareci/sobolani, cobai, iepuri —1950 lej — Institutul National de Cercetare Dezvoltare Medico DA20858880 Furaje uscate (Rev.2) Bucuresti 15712000-2
16.07.2018Separatoare plastic diverse culori 1-31 —77 lej — Dns Birotica S.R.L. DA20845389 Articole de birou (Rev.2) Bucuresti 39263000-3
13.07.2018Modul memorie RAM 8 Gb —1371 lej — Iren Computers srl DA20842556 Diverse piese de schimb (Rev.2) Bucuresti 34913000-0
10.07.2018Acetona 99,5%; Alcool etilic absolut, puritate >99,8% —210 lej — Laboratorium Life Science Srl DA20812562 Reactivi chimici (Rev.2) Targu Bujor 33696300-8
10.07.2018GENTAMICIN SOLUTION BIOREAGNT 50MG/ML —757 lej — Redox Research & Analytic S.R.L. DA20812320 Reactivi chimici (Rev.2) Otopeni 33696300-8
10.07.2018Laser/Scanner assembly; Transfer roller assembly; Fuser assembly - For 220 VAC —2164 lej — Iren Computers srl DA20811814 Diverse piese de schimb (Rev.2) Bucuresti 34913000-0
09.07.2018Eppendorf Safe-Lock Tubes, 0.5 mL, PCR clean, colorless, 500 pcs. —410 lej — Elta 90 Medical Research Srl DA20805792 Consumabile medicale (Rev.2) Bucuresti 33140000-3
09.07.2018Eppendorf Safe-Lock Tubes, 0.5 mL, PCR clean, colorless, 500 pcs. —205 lej — Elta 90 Medical Research Srl DA20805772 Consumabile medicale (Rev.2) Bucuresti 33140000-3
09.07.2018Amorsa sonda PCR King S FAMCCACGGGAGGAATACCAACCCAGTG —1440 lej — Filara BioMed Srl DA20799110 Truse de diagnosticare (Rev.2) Cluj-Napoca 33141625-7
09.07.2018Amorsa PCR primer King_F CTGCTCATGGTATCAATCTTATCGA —70 lej — Filara BioMed Srl DA20799083 Truse de diagnosticare (Rev.2) Cluj-Napoca 33141625-7
09.07.2018Amorsa PCR primer King_R GATACCACAAGATCRGCCGT —70 lej — Filara BioMed Srl DA20799019 Truse de diagnosticare (Rev.2) Cluj-Napoca 33141625-7
09.07.2018AmpliTaq Gold™ DNA Polymerase with Gold Buffer and MgCl2, 250unitati —8360 lej — Antisel Ro Srl DA20798936 Truse de diagnosticare (Rev.2) Bucuresti 33141625-7
09.07.2018Congelator Indesit UI61W.1, 232l, A+, Alb [UI61W.1] —2151 lej — Dante International S.A. DA20798892 Diverse aparate si produse medicale (Rev Bucuresti 33190000-8
09.07.2018Frigider cu doua usi Arctic AD70410+, 397 l, Clasa A+, 170.5 cm inaltime, 70 cm latime, Alb [AD7041 —1277 lej — Dante International S.A. DA20798846 Diverse aparate si produse medicale (Rev Bucuresti 33190000-8
05.07.2018Reactivi si produse de contrast —2159 lej — Novaintermed S.R.L. DA20786429 Reactivi si produse de contrast (Rev.2) Pipera (Voluntari) 33696000-5
05.07.2018Filtre Milipore de 0.22 µm: 500 bucati —3190 lej — Tyd Elan S.R.L. DA20785567 Consumabile medicale (Rev.2) Bucuresti 33140000-3
03.07.2018Sange defibrinat de berbec —159 lej — Institutul National de Cercetare Dezvoltare Medico DA20758636 Reactivi chimici (Rev.2) Bucuresti 33696300-8
27.06.2018Dosing Heads —705 lej — Medicamed Market S.R.L. DA20724456 Consumabile medicale (Rev.2) Bucuresti 33140000-3
27.06.2018Apa distilata sterila demineralizata SENSITITRE —339 lej — Medicamed Market S.R.L. DA20724387 Reactivi chimici (Rev.2) Bucuresti 33696300-8
27.06.2018Placi microt tip EUVSEC2 pt. Salmonella spp si E.coli rezist.la cefalosporine gen a3-a si meropenem —2286 lej — Medicamed Market S.R.L. DA20722850 Reactivi chimici (Rev.2) Bucuresti 33696300-8
27.06.2018Placi de microtitrare tip EUVSEC pt test. comport. la antimicrob.tulpinilor Salmonella spp si E.Coli —3048 lej — Medicamed Market S.R.L. DA20722628 Truse de diagnosticare (Rev.2) Bucuresti 33141625-7
27.06.2018Placi de microtitrare Stafilococi de tip EUST —3048 lej — Medicamed Market S.R.L. DA20722590 Reactivi chimici (Rev.2) Bucuresti 33696300-8
27.06.2018Placi de microtitrare Enterococi de tip EUVENC —3048 lej — Medicamed Market S.R.L. DA20722556 Reactivi chimici (Rev.2) Bucuresti 33696300-8

Szűrők minden oszlopon: egyszerű szöveg, a|b (bármelyik), !x (nélküle), >1000, 10-50, >2 mil. A fejlécre kattintva rendezhetsz; az „Oszlopok" elrejt/megjelenít; az export csak a szűrt sorokat viszi. Az oszlopszűrők és a rendezés a megnyitott oldalon működnek; a fenti keresés és a hivatkozások (kórház, beszállító, kategória) a teljes listát szűkítik.